| |
| |
| |
| |
| |
| |
Gene Symbol |
Lta4h |
Gene Name |
Leukotriene A-4 hydrolase |
Chromosome |
10 |
Celera ID Ensembl ID |
mCG5142 ENSMUSG00000015889 |
ES Cell Line |
E14Tg2a |
Probe Primers |
ACGAATTCAACCAGAGGGTTCC |
|
Phenotype
|
|
Related
Publications |
Byrum RS, Goulet JL, Snouwaert JN, Griffiths RJ, Koller BH. Determination
of the contribution of cysteinyl leukotrienes and leukotriene B4
in acute inflammatory responses using 5-lipoxygenase- and leukotriene
A4 hydrolase-deficient mice. J Immunol. 1999 Dec 15;163(12):6810-9. |
