Gene Symbol

Ptgs1 (COX1)

Gene Name

prostaglandin-endoperoxide synthase 1
(cyclooxygenase 1)

Chromosome

2

Celera ID
Ensembl ID

Jackson Labs COX1 Link

mCG22272
ENSMUSG00000026897


ES Cell Line

E14TG2a


Targeting Construct

 
PCR Primers


5' AGGAGATGGCTGCTGAGTTGG
3' AATCTGACTTTCTGAGTTGCC
Targeted GCAGCCTCTGTTCCACATACAC

 

Phenotype

 

 

 



 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Related Publications

 

Cheng Y, Austin SC, Rocca B, Koller BH, Coffman TM, Grosser T, Lawson JA,
FitzGerald GA. Role of prostacyclin in the cardiovascular response to thromboxane A2. Science. 2002 Apr 19;296(5567):539-41.

Coggins KG, Latour A, Nguyen MS, Audoly L, Coffman TM, Koller BH.
Metabolism of PGE2 by prostaglandin dehydrogenase is essential for remodeling
the ductus arteriosus. Nat Med. 2002 Feb;8(2):91-2.

Tilley SL, Coffman TM, Koller BH. Mixed messages: modulation of inflammation and immune responses by prostaglandins and thromboxanes. J Clin Invest. 2001 Jul;108(1):15-23. Review.

Fabre JE, Nguyen M, Athirakul K, Coggins K, McNeish JD, Austin S, Parise LK, FitzGerald GA, Coffman TM, Koller BH. Activation of the murine EP3 receptor for PGE2 inhibits cAMP production and promotes platelet aggregation.
J Clin Invest. 2001 Mar;107(5):603-10.

Loftin CD, Trivedi DB, Tiano HF, Clark JA, Lee CA, Epstein JA, Morham SG,
Breyer MD, Nguyen M, Hawkins BM, Goulet JL, Smithies O, Koller BH, Langenbach R. Failure of ductus arteriosus closure and remodeling in neonatal mice deficient in cyclooxygenase-1 and cyclooxygenase-2. Proc Natl Acad Sci U S A. 2001 Jan 30;98(3):1059-64.

Solle M, Labasi J, Perregaux DG, Stam E, Petrushova N, Koller BH, Griffiths
RJ, Gabel CA. Altered cytokine production in mice lacking P2X(7) receptors.
J Biol Chem. 2001 Jan 5;276(1):125-32.