Gene Symbol

 Ptger3

Gene Name

prostaglandin-E receptor 3 (subtype EP3)

Chromosome

 3
Celera ID
Ensembl ID
 mCG2590
ENSMUSG00000040016

ES Cell Line

 E14TG2a
 
Probe Primers


Foreward CCACATGAAGACTCGCGC
Reverse GTTCAGCGAAGCCAGGCGAAC

 

Phenotype

 

EP3 (-/-) mice cannot be distinguished from wild type by simple observation. Histology revealed no physiological changes resulting from loss in receptor expression.



 

 

 

 

 

 

 

 

 

 

 

 

 

Related Publications

Nguyen M, Solle M, Audoly LP, Tilley SL, Stock JL, McNeish JD, Coffman TM, Dombrowicz D, Koller BH. Receptors and signaling mechanisms required for prostaglandin E2-mediated regulation of mast cell degranulation and IL-6 production. J Immunol. 2002 Oct 15;169(8):4586-93.

Nataraj C, Thomas DW, Tilley SL, Nguyen MT, Mannon R, Koller BH, Coffman TM. Receptors for prostaglandin E(2) that regulate cellular immune responses in the mouse. J Clin Invest. 2001 Oct;108(8):1229-35.

Fabre JE, Nguyen M, Athirakul K, Coggins K, McNeish JD, Austin S, Parise LK, FitzGerald GA, Coffman TM, Koller BH. Activation of the murine EP3 receptor for PGE2 inhibits cAMP production and promotes platelet aggregation.
J Clin Invest. 2001 Mar;107(5):603-10.

Audoly LP, Ruan X, Wagner VA, Goulet JL, Tilley SL, Koller BH, Coffman TM,
Arendshorst WJ. Role of EP(2) and EP(3) PGE(2) receptors in control of murine renal hemodynamics. Am J Physiol Heart Circ Physiol. 2001 Jan;280(1):H327-33.

Audoly LP, Tilley SL, Goulet J, Key M, Nguyen M, Stock JL, McNeish JD,
Koller BH, Coffman TM. Identification of specific EP receptors responsible for the hemodynamic effects of PGE2. Am J Physiol. 1999 Sep;277(3 Pt 2):H924-30.

Fleming EF, Athirakul K, Oliverio MI, Key M, Goulet J, Koller BH, Coffman
TM. Urinary concentrating function in mice lacking EP3 receptors for prostaglandin E2. Am J Physiol. 1998 Dec;275(6 Pt 2):F955-61.