Mutant Generation
Can’t find the line? Generate it!
To generate mutant lines:
- Select a gene editing technology
- CRISP/CAS-9
- TALEN
- 5′ T rule
- spacer size (12-14)
- TALEN arm size (15-20)
- avoid CpGs
- ZFN
- Select a target site
- Using Ensembl’s main zebrafish browser or Sanger Center’s Vega site, select one gene transcript and choose an exon upstream of domains with suspected essential biological activity.
- Paste the sequence into ZiFiT Targeter to get the target sequence and oligos that need to be purchased.
- Use New England BioLab’s Enzyme Finder to locate an enzyme that will cut the mutant, but not the wild-type strands.
Example Targetsite Selection
| Gene | trpv1 | Selected based on research goals |
| Tool | CRISPR/CAS nucleases | Nucleases cut both strands |
| Transcript | trpv1-201 | Chose the longer of the two |
| Location | Chromosome 5: 43,754,941-43,777,138 forward strand | |
| Exon | 2 | Upstream of essential function |
| Targetsite | GGTGATGTGTCTAAAATGCA | |
| Given the high number of SNPs in zebrafish, it is advisable (although, optional) to sequence the region of interest in the strain of embryos intended for injection. This will ensure that a polymorphism will not affect the target site, reducing mutation efficiency. |
- Generate tools according to commercially available kit instructions
- Validate nuclease activity with HRMA and/or sequencing
- Make mosaic P0 founders and breed to wild-type for F1
- Screen F1 generation
- Genotyping can be performed on either embryos or fin clips using either HRMA or PCR.
- Breed F1xF1 for F2 -/- mutants and evaluate phenotype